About   Help   FAQ
Xkr4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Xkr4em1(IMPC)J
Name: X-linked Kx blood group related 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5825311
Synonyms: Xkr4em1J
Gene: Xkr4  Location: Chr1:3276124-3741721 bp, - strand  Genetic Position: Chr1, 1.6 cM
Alliance: Xkr4em1(IMPC)J page
IMPC: Xkr4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Xkr4-8176J-F8924 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCCCAATTCAGAAACCAAA, CCTCCAGCTGTCACTTTAAC, ACAGTCTTACTAGCTCAGTT and GTACGAAAGGAAAATGACTT, which resulted in a 278 bp deletion beginning at Chromosome 1 negative strand position 3,421,962 bp, CTTTGGAGTTTGAATTTCAA, and ending after AAGGTAAGGATTTGCCATTT at 3,421,685 bp (GRCm38/mm10). This mutation deletes exon 2 and 78 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp deletion (TTTAAC) in the intron 95 bp before the deletion that will not alter the effect of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 266 and early truncation 26 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Xkr4 Mutation:  39 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory