Gramd2bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Gramd2bem1(IMPC)J |
Name: |
GRAM domain containing 2B; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5825313 |
Synonyms: |
Gramd3em1J |
Gene: |
Gramd2b Location: Chr18:56533412-56636864 bp, + strand Genetic Position: Chr18, 30.43 cM, cytoband D2
|
Alliance: |
Gramd2bem1(IMPC)J page
|
IMPC: |
Gramd2b gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Gramd3-8350J-M0605 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCCTTGCATAATCTCCGT, CTTTCTGCAGTTCATCACGA, GGTCAGCTGTGGAATCGAAT and TGCGACTCTATTATCGTGAG, which resulted in a 279 bp deletion beginning at Chromosome 18 positive strand position 56,474,000 bp GTGGGTTTTATTTCCCCAGG, and ending after ACTGTTCCTCCAGCCTATTC at 56,474,278 bp (GRCm38/mm10). This mutation deletes exon 3 and 167 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 20 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|