About   Help   FAQ
Gramd2bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gramd2bem1(IMPC)J
Name: GRAM domain containing 2B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5825313
Synonyms: Gramd3em1J
Gene: Gramd2b  Location: Chr18:56533412-56636864 bp, + strand  Genetic Position: Chr18, 30.43 cM, cytoband D2
Alliance: Gramd2bem1(IMPC)J page
IMPC: Gramd2b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Gramd3-8350J-M0605 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCCTTGCATAATCTCCGT, CTTTCTGCAGTTCATCACGA, GGTCAGCTGTGGAATCGAAT and TGCGACTCTATTATCGTGAG, which resulted in a 279 bp deletion beginning at Chromosome 18 positive strand position 56,474,000 bp GTGGGTTTTATTTCCCCAGG, and ending after ACTGTTCCTCCAGCCTATTC at 56,474,278 bp (GRCm38/mm10). This mutation deletes exon 3 and 167 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 20 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gramd2b Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory