Bckdhb^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bckdhb^em1(IMPC)J
• Name: branched chain ketoacid dehydrogenase E1, beta polypeptide; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5825325
• Synonyms: Bckdhb^-, Bckdhb^em1J
• Gene: Bckdhb Location: Chr9:83807198-84006293 bp, + strand Genetic Position: Chr9, 45.67 cM
• Alliance: Bckdhb^em1(IMPC)J page
• IMPC: Bckdhb gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Bckhb-8188J-M1369 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAAATCCCAGGTATCTCAA, CAATACGCATCTGAAAATGA, GCAGTTCGCATTTTGTAGAG and TGAGGGTCTCCAGCTTTCCG, which resulted in a 528 bp deletion beginning at Chromosome 9 positive strand position 83,988,526 bp, TTGAGATACCTGGGATTTGC, and ending after GCAGTTCGCATTTTGTAGAG at 83,989,053 bp (GRCm38/mm10). This mutation deletes exon 4 and 394 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 112 and early truncation 13 amino acids later. Western blot analysis confirmed the absence of the protein in the liver, heart and brain of homozygous mutant neonates. (J:188991, J:344897)
• Inheritance: Not Specified

Disease models

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Bckdhb Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)