Rnf24^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rnf24^em1(IMPC)J
• Name: ring finger protein 24; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5825334
• Synonyms: Rnf24^em1J
• Gene: Rnf24 Location: Chr2:131139984-131194766 bp, - strand Genetic Position: Chr2, 63.32 cM
• Alliance: Rnf24^em1(IMPC)J page
• IMPC: Rnf24 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rnf24-8318J-M9794 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATGCACTCCATTAAGTCAG, TCTGTGGTATAAACTGACAA, ATTTCTCTAGAACTTAAGAG and GTACTATCCCATGGTTCAGT, which resulted in a 344 bp deletion beginning at Chromosome 2 negative strand position 131,308,577 bp, TGGTTCAGTGGGAACTCTCT, and ending after CAGTATTTGTCGAAGAAAAA at 131,308,234 bp (GRCm38/mm10). This mutation deletes exon 3 and 301 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 14 bp deletion (GAACTTAAGAGTGGG) 10 bp before the 344 bp deletion and an 8 bp deletion (TTTGATGT) 57 bp before the 344 bp deletion, neither of which are expected to alter the effect of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 49 and early truncation 1 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rnf24 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)