About   Help   FAQ
Rnf24em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rnf24em1(IMPC)J
Name: ring finger protein 24; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5825334
Synonyms: Rnf24em1J
Gene: Rnf24  Location: Chr2:131139984-131194766 bp, - strand  Genetic Position: Chr2, 63.32 cM
Alliance: Rnf24em1(IMPC)J page
IMPC: Rnf24 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rnf24-8318J-M9794 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATGCACTCCATTAAGTCAG, TCTGTGGTATAAACTGACAA, ATTTCTCTAGAACTTAAGAG and GTACTATCCCATGGTTCAGT, which resulted in a 344 bp deletion beginning at Chromosome 2 negative strand position 131,308,577 bp, TGGTTCAGTGGGAACTCTCT, and ending after CAGTATTTGTCGAAGAAAAA at 131,308,234 bp (GRCm38/mm10). This mutation deletes exon 3 and 301 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 14 bp deletion (GAACTTAAGAGTGGG) 10 bp before the 344 bp deletion and an 8 bp deletion (TTTGATGT) 57 bp before the 344 bp deletion, neither of which are expected to alter the effect of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 49 and early truncation 1 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rnf24 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory