Ptprk^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ptprk^em1(IMPC)J
• Name: protein tyrosine phosphatase receptor type K; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5827691
• Synonyms: Ptprk^em1J
• Gene: Ptprk Location: Chr10:27950816-28473393 bp, + strand Genetic Position: Chr10, 15.06 cM
• Alliance: Ptprk^em1(IMPC)J page
• IMPC: Ptprk gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ptprk-8356J-M669 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTAAGAACATTGATAAGCCA, TCTTGACTGATATTTTTCTA, ACAAACCAGAAAAATCTCAG and TTCCCAACTCCTTCTTGAGG, which resulted in a 555 bp deletion beginning at Chromosome 10 positive strand position 28,263,339 bp, TTTTCTATGGCCCTGCCCCA, and ending after TGTTTCCCAACTCCTTCTTG at 28,263,893 bp (GRCm38/mm10). This mutation deletes exon 3 and 283 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ptprk Mutation: 127 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)