Ptprkem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ptprkem1(IMPC)J |
Name: |
protein tyrosine phosphatase receptor type K; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5827691 |
Synonyms: |
Ptprkem1J |
Gene: |
Ptprk Location: Chr10:27950816-28473393 bp, + strand Genetic Position: Chr10, 15.06 cM
|
Alliance: |
Ptprkem1(IMPC)J page
|
IMPC: |
Ptprk gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Ptprk-8356J-M669 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTAAGAACATTGATAAGCCA, TCTTGACTGATATTTTTCTA, ACAAACCAGAAAAATCTCAG and TTCCCAACTCCTTCTTGAGG, which resulted in a 555 bp deletion beginning at Chromosome 10 positive strand position 28,263,339 bp, TTTTCTATGGCCCTGCCCCA, and ending after TGTTTCCCAACTCCTTCTTG at 28,263,893 bp (GRCm38/mm10). This mutation deletes exon 3 and 283 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 2 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
4 reference(s) |
|