About   Help   FAQ
Ptprkem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ptprkem1(IMPC)J
Name: protein tyrosine phosphatase receptor type K; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5827691
Synonyms: Ptprkem1J
Gene: Ptprk  Location: Chr10:27950816-28473393 bp, + strand  Genetic Position: Chr10, 15.06 cM
Alliance: Ptprkem1(IMPC)J page
IMPC: Ptprk gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ptprk-8356J-M669 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTAAGAACATTGATAAGCCA, TCTTGACTGATATTTTTCTA, ACAAACCAGAAAAATCTCAG and TTCCCAACTCCTTCTTGAGG, which resulted in a 555 bp deletion beginning at Chromosome 10 positive strand position 28,263,339 bp, TTTTCTATGGCCCTGCCCCA, and ending after TGTTTCCCAACTCCTTCTTG at 28,263,893 bp (GRCm38/mm10). This mutation deletes exon 3 and 283 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ptprk Mutation:  127 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/22/2024
MGI 6.24
The Jackson Laboratory