Kynu^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kynu^em1(IMPC)J
• Name: kynureninase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5827722
• Synonyms: Kynu^em1J
• Gene: Kynu Location: Chr2:43445341-43572734 bp, + strand Genetic Position: Chr2, 25.64 cM, cytoband C1
• Alliance: Kynu^em1(IMPC)J page
• IMPC: Kynu gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Kynu-8351J-M627 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGCATAACTTAAACCCACAG, CTTCCAATCACAAATAGCCA, CTTCTTTGCTGGACATTAAA and TGGAGTTACACCTTTTAACT, which resulted in a deletion of 340 bp in total. This deletion begins at Chromosome 2 positive strand position 43,581,141 bp, CCTCTGTGGGTTTAAGTTA, removes 19 bp, then retains 3 endogenous bases (TGC) in the intron, and then removes 321 bp, ending after GATGTAAGTACCAAGTTAAA at 43,581,483 bp (GRCm38/mm10). This mutation deletes exon 3 and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Kynu Mutation: 33 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)