About   Help   FAQ
Kynuem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Kynuem1(IMPC)J
Name: kynureninase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5827722
Synonyms: Kynuem1J
Gene: Kynu  Location: Chr2:43445341-43572734 bp, + strand  Genetic Position: Chr2, 25.64 cM, cytoband C1
Alliance: Kynuem1(IMPC)J page
IMPC: Kynu gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Kynu-8351J-M627 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGCATAACTTAAACCCACAG, CTTCCAATCACAAATAGCCA, CTTCTTTGCTGGACATTAAA and TGGAGTTACACCTTTTAACT, which resulted in a deletion of 340 bp in total. This deletion begins at Chromosome 2 positive strand position 43,581,141 bp, CCTCTGTGGGTTTAAGTTA, removes 19 bp, then retains 3 endogenous bases (TGC) in the intron, and then removes 321 bp, ending after GATGTAAGTACCAAGTTAAA at 43,581,483 bp (GRCm38/mm10). This mutation deletes exon 3 and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Kynu Mutation:  32 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory