Gsto1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gsto1^em1(IMPC)J
• Name: glutathione S-transferase omega 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5827741
• Synonyms: Gsto1^em1J
• Gene: Gsto1 Location: Chr19:47843412-47853229 bp, + strand Genetic Position: Chr19, 40.41 cM
• Alliance: Gsto1^em1(IMPC)J page
• IMPC: Gsto1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Gsto1-8314J-F9698 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAGGAGGGCATCTGACCCA, AATCGGGCCACACTAATTCA, ACTCAGCGCTGCCTTTGTGA and AGCAGGAACAGAGCGTGCCA, which resulted in a deletion of 443 bp in total. This deletion begins at Chromosome 19 positive strand position 47,857,710 bp deleting 21 bp, CCCAGGGTCTTAACCTTCGGG, then retains 4 endogenous bp (TGCA) in the intron, then removes 422 bp ending after ACTCAGCGCTGCCTTTGTGA at 47,858,156 bp (GRCm38/mm10). This mutation deletes exon 3 and 223 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gsto1 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)