Lpgat1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lpgat1^em1(IMPC)J
• Name: lysophosphatidylglycerol acyltransferase 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5829401
• Synonyms: Lpgat1^em1J
• Gene: Lpgat1 Location: Chr1:191449946-191516367 bp, + strand Genetic Position: Chr1, 96.78 cM
• Alliance: Lpgat1^em1(IMPC)J page
• IMPC: Lpgat1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Lpgat1-8352J-F7972 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAACTTAGATGTTTACCAAC, ATTTTTCTAAGTTTGAAACT, CCTCGGGAGGATATCCTGCA and GTCTTAAAATTCCCTTCCTG, which resulted in a 585 bp deletion beginning at Chromosome 1 positive strand position 191,749,206 bp TGAATTCTTTCCCATGATAT, 15 bases later there is retention of 5 endogenous bp (TAAGT) in the intron, and ending after CAGGAAGGGAATTTTAAGAC at 191,749,795 bp (GRCm38/mm10). This mutation deletes exon 3 and 466 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 48 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Lpgat1 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 6 reference(s)