Prkag2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prkag2^em1(IMPC)J
• Name: protein kinase, AMP-activated, gamma 2 non-catalytic subunit; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5829423
• Synonyms: Prkag2^em1J
• Gene: Prkag2 Location: Chr5:25067742-25305640 bp, - strand Genetic Position: Chr5, 11.93 cM
• Alliance: Prkag2^em1(IMPC)J page
• IMPC: Prkag2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Prkag2-8317J-M9745 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTACCTGCTCTAGTCCTCCG, TTGATGCTATGGTTTCAGGT, GCTGTCTAACAGAGCCTCAA and GCATTCCCTTGTCACCTCTG, which resulted in a 686 bp deletion beginning at Chromosome 5 negative strand position 25,022,291 bp AGGCTCTGTTAGACAGCTCC, and ending after TGCTCTAGTCCTCCGGGGTG at 25,021,606 bp (GRCm38/mm10). This mutation deletes exon 3 and 406 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 13 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Prkag2 Mutation: 53 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)