Sel1l3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sel1l3^em1(IMPC)J
• Name: sel-1 suppressor of lin-12-like 3 (C. elegans); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5829466
• Synonyms: Sel1l3^em1J
• Gene: Sel1l3 Location: Chr5:53264425-53370794 bp, - strand Genetic Position: Chr5, 28.96 cM
• Alliance: Sel1l3^em1(IMPC)J page
• IMPC: Sel1l3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Sel1l3-8391J-F4781 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTGTCATCGCACAACAGCA, CAAGAATGTGCTGTGCCACG, ATTCCCGAGCTGGCTTCCGA and AACATCTGCTGATCAAAATG, which resulted in a 928 bp deletion beginning at Chromosome 5 negative strand position 53,200,761 bp CGGAAGCCAGCTCGGGAATG, and ending after GCCGGTGTCATCGCACAACA at 53,199,834 bp (GRCm38/mm10). This mutation deletes exon 2 and 357 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 9 bp insertion (TTTTTTTTT) at the deletion site that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 59 and early truncation 19 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sel1l3 Mutation: 57 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)