About   Help   FAQ
Agbl1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Agbl1em1(IMPC)J
Name: ATP/GTP binding protein-like 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5882076
Synonyms: Agbl1em1J
Gene: Agbl1  Location: Chr7:75879635-76774446 bp, + strand  Genetic Position: Chr7, 43.87 cM
Alliance: Agbl1em1(IMPC)J page
IMPC: Agbl1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Agbl1-8255J-F6210 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTTCCATGATGAATCTGGA, ACAGTGCTCTTGCTTAATAA, TCCAGACATCACTATCGTTG and ATGAATATTATTGCAACCAA, which resulted in a two part deletion of 266 bp in total. This deletion begins at Chromosome 7 positive strand position 76,414,540 bp, deletes 17 bp, CTTAATAATGGGTCCCT, then retains 4 endogenous bp (CATT) of the intron, then removes 249 bp ending after TGAACTTACCCCAACGATAG at 76,414,809 bp (GRCm38/mm10). This mutation deletes exon 9 and 201 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 300 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Agbl1 Mutation:  63 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory