About   Help   FAQ
Itgb3bpem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Itgb3bpem1(IMPC)J
Name: integrin beta 3 binding protein (beta3-endonexin); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5883322
Synonyms: Itgb3bpem1J
Gene: Itgb3bp  Location: Chr4:99655643-99717403 bp, - strand  Genetic Position: Chr4, 45.71 cM, cytoband C6
Alliance: Itgb3bpem1(IMPC)J page
IMPC: Itgb3bp gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Itgb3bp-8308J-F0692 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATAGCTCTTGTTGCAGCT, TTATAATTGATAGTAGCTGA, AAGTAGCTACCTTATTTGAG and GAGTTTTCATGAGTTACTTA, which resulted in a 2 part deletion of 558 bp in total. This deletion begins at Chromosome 4 negative strand position 99,802,399 bp TTTGAGAGGAATACTGGTCA, removes 222 bp then retains 4 endogenous exonic bases (CTAC) and ends after TATGGCCTGACTGCCTTCAG at 99,801,838 bp (GRCm38/mm10). This mutation deletes 132 bp in exon 3 and 426 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 17 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Itgb3bp Mutation:  16 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory