Ccng2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccng2^em1(IMPC)J
• Name: cyclin G2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5883421
• Synonyms: Ccng2^em1J
• Gene: Ccng2 Location: Chr5:93415432-93424090 bp, + strand Genetic Position: Chr5, 47.29 cM, cytoband E3.3-F1.3
• Alliance: Ccng2^em1(IMPC)J page
• IMPC: Ccng2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ccng2-8345J-F4819 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCATCTAAGAGAAGCAACA, CTGAAATGTAAAATGATTGT, GTCTGTCCAGACTTTCGACT and GCAGCCACGCTGAAGGCCTG, which resulted in a 407 bp deletion beginning at Chromosome 5 positive strand position 93,270,724 bp ATGGCATTATTTCAAGCGTC, and ending after AGTCTGTCCAGACTTTCGAC at 93,271,130 bp (GRCm38/mm10). This mutation deletes exon 4 and 156 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 92 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccng2 Mutation: 51 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)