About   Help   FAQ
Ccng2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccng2em1(IMPC)J
Name: cyclin G2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5883421
Synonyms: Ccng2em1J
Gene: Ccng2  Location: Chr5:93415432-93424090 bp, + strand  Genetic Position: Chr5, 47.29 cM, cytoband E3.3-F1.3
Alliance: Ccng2em1(IMPC)J page
IMPC: Ccng2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ccng2-8345J-F4819 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCATCTAAGAGAAGCAACA, CTGAAATGTAAAATGATTGT, GTCTGTCCAGACTTTCGACT and GCAGCCACGCTGAAGGCCTG, which resulted in a 407 bp deletion beginning at Chromosome 5 positive strand position 93,270,724 bp ATGGCATTATTTCAAGCGTC, and ending after AGTCTGTCCAGACTTTCGAC at 93,271,130 bp (GRCm38/mm10). This mutation deletes exon 4 and 156 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 92 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccng2 Mutation:  51 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory