Ubiad1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ubiad1^em1(IMPC)J
• Name: UbiA prenyltransferase domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5896808
• Gene: Ubiad1 Location: Chr4:148518952-148529217 bp, - strand Genetic Position: Chr4, 78.76 cM, cytoband E1
• Alliance: Ubiad1^em1(IMPC)J page
• IMPC: Ubiad1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ubiad1-8387J-M4740 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTTAGGGAGAAGTGCCATA, ACTGTTCCCAAATTCATCAC, AGAATACCATGTCTGAAGAG and TCCGGGTACACAGAGATGAG, which resulted in a 2599 bp deletion beginning at Chromosome 4 negative strand position 148,436,873 bp, TCTCTGTGTACCCGGAGCTC, and ending after AGGACTTAGGGAGAAGTGCC at 148,434,275 bp (GRCm38/mm10). This mutation deletes exon 2 and 451 bp of flanking intronic sequence including the splice acceptor and is predicted to cause early truncation after amino acid residue 174. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ubiad1 Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)