Dusp15^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dusp15^em1(IMPC)J
• Name: dual specificity phosphatase-like 15; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5897441
• Gene: Dusp15 Location: Chr2:152782917-152793618 bp, - strand Genetic Position: Chr2, 75.41 cM
• Alliance: Dusp15^em1(IMPC)J page
• IMPC: Dusp15 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Dusp15-8505J-0098M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGTTGGTGAGCCTTGGGA, ACCAAGGTTGACCTTCGTGT, ACCAATAGAGAAGAGCTGCG and GTCTCAGGTAGAGATCAGGG, which resulted in a 553 bp deletion in total, beginning at Chromosome 2 negative strand position 152,950,921 bp, TGATCTCTACCTGAGACTTC, deleting 385 bp then retaining 4 endogenous bp (ACTT) in the intron, then removing 168 bp, and ending after AGGCTAAAGGCCCACACGAA at 152,950,365 bp (GRCm38/mm10). This mutation deletes exon 2 and 519 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 7 and early truncation 79 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dusp15 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)