About   Help   FAQ
Del(7)3J
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(7)3J
Name: deletion Chr 7, Jackson 3
MGI ID: MGI:5897840
Synonyms: Hspb6em1(IMPC)J
Gene: Del(7)3J  Location: unknown  Genetic Position: Chr7, Syntenic
IMPC: Del(7)3J gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Deletion
  Del(7)3J involves 2 genes/genome features (Hspb6, Lin37) View all
 
Mutation detailsThis deletion was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGACAGTCTACACAAGTCCT, ACTTGGTTACCACAAAGAGG, GGATTTAGCAACTGCTACAG and CAACTGCTACAGAGGACACT, which resulted in a 1488 bp deletion beginning at Chromosome 7 positive strand position 30,554,158bp, CCTCGGCAGCAGCACTGTAA, and ending after GGATTTAGCAACTGCTACAG at 30,555,645 bp (GRCm38/mm10) that disrupts both Hspb6 and Lin37. From Hspb6 ENSMUSE00001259506 and ENSMUSE00000803270 (exons 2 and 3) are deleted along with 390 bp of flanking intronic sequence including the splice acceptor and donor, which is predicted to cause a change in amino acids sequence after residue 67 and early truncation 20 amino acids later due to read through. From Lin37 ENSMUSE00000675817 (exon 9) is deleted along with 36 bp of the flanking intron, and this exon deletion is predicted to cause an early stop after residue 208 in Lin37. In addition, there is a 2 bp (AG) deletion 84 bp before the 1488 bp deletion and a single bp insertion (T) at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Del(7)3J Mutation:  1 strain or line available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/24/2024
MGI 6.24
The Jackson Laboratory