About   Help   FAQ
Esdem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Esdem1(IMPC)J
Name: esterase D/formylglutathione hydrolase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5897850
Gene: Esd  Location: Chr14:74969737-74988205 bp, + strand  Genetic Position: Chr14, 39.38 cM, cytoband D2-E2
Alliance: Esdem1(IMPC)J page
IMPC: Esd gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Esd-8515J-1863F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATGTGCGTCTACACACAA, CTACTTTTTGAGATACATAA, GCGATGTTGAGAGATAACCT and TTATTAGCTGATGACCAACT, which resulted in a 427 bp deletion beginning at Chromosome 14 positive strand position 74,741,754 bp, TGTATCTCAAAAAGTAGAAG, and ending after TATTAGCTGATGACCAACTG at 74,742,180 bp (GRCm38/mm10). This mutation deletes exon 5 and 302 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp insertion (GT) at the site of the deletion and a single bp insertion (T) in the intron 194 bp downstream of the deletion that will not alter the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 85 and early truncation 61 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Esd Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory