Apol8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Apol8^em1(IMPC)J
• Name: apolipoprotein L 8; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5897852
• Gene: Apol8 Location: Chr15:77631998-77641203 bp, - strand Genetic Position: Chr15, 36.79 cM
• Alliance: Apol8^em1(IMPC)J page
• IMPC: Apol8 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Apol8-8505J-5445F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGAAGCTGAGAGCCATCGGA, ACTGGGTGAGGAAGACACGG, TGGTCCCACCTAAGGAGGCG and TCCCAACACCAGCTCTCCAG, which resulted in a 522 bp deletion beginning at Chromosome 15 negative strand position 77,753,103 bp, GCTCTCCAGGGGTGGGTGTC, and ending after AAGCTGAGAGCCATCGGAAG at 77,752,582 bp (GRCm38/mm10). This mutation deletes exon 3 and 395 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 10 and early truncation 42 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Apol8 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)