Polr1c^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Polr1c^em1(IMPC)J
• Name: polymerase (RNA) I polypeptide C; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5901842
• Gene: Polr1c Location: Chr17:46554846-46558971 bp, - strand Genetic Position: Chr17, 22.9 cM
• Alliance: Polr1c^em1(IMPC)J page
• IMPC: Polr1c gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Polr1c-8545J-8326M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTACATCTGCCTTCGCCT, CCTACTGCTGGGGCTTTAGT, ACCACCCTACCTGCCCCAGA and GGTTCACACCTATGACAGTC, which resulted in a 535 bp deletion beginning at Chromosome 17 negative strand position 46,246,036 bp, CTGGGGCAGGTAGGGTGGTT, and ending after TCTTGTACATCTGCCTTCGC at 46,245,502 bp (GRCm38/mm10). This mutation deletes exon 4 and 402 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 83 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Polr1c Mutation: 32 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)