Phkb^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Phkb^em1(IMPC)J
• Name: phosphorylase kinase beta; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5901846
• Gene: Phkb Location: Chr8:86567588-86788005 bp, + strand Genetic Position: Chr8, 41.61 cM
• Alliance: Phkb^em1(IMPC)J page
• IMPC: Phkb gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Phkb-8543J-8397M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAATGCTCTAAGTAGTTGG, TGTGCAGTATGGATTTGCAG, GTTCTCCTGCTAACTCCACG and CTCGTCCACGTGGAGTTAGC, which resulted in a 329 bp deletion beginning at Chromosome 8 positive strand position 85,877,961 bp, ATTTGCAGTGGGCTAGAGTT, and ending after TGCTAACTCCACGTGGACGA at 85,878,289 bp (GRCm38/mm10). This mutation deletes exon 4 and 190 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 47 and early truncation 17 amino acids later. (J:188991)
• Inheritance: Not Specified

Disease models

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Phkb Mutation: 72 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)