Mylk4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mylk4^em1(IMPC)J
• Name: myosin light chain kinase family, member 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5901850
• Gene: Mylk4 Location: Chr13:32884810-32967937 bp, - strand Genetic Position: Chr13, 13.72 cM
• Alliance: Mylk4^em1(IMPC)J page
• IMPC: Mylk4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Mylk4-8533J-952F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATACTTCTGGTTTAACAT, AGGCTCCCTGATTTTACTGA, TTACTTGGTGCAGAAAGGAG and GCGAGAAATCTGAAGTTCCA, which resulted in a 584 bp deletion beginning at Chromosome 13 negative strand position 32,725,161 bp, GAACTTCAGATTTCTCGCTG, and ending after ATACTTCTGGTTTAACATTG at 32,724,578 bp (GRCm38/mm10). This mutation deletes exon 3 and 478 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 16 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mylk4 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)