Hmg20a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hmg20a^em1(IMPC)J
• Name: high mobility group 20A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5901855
• Gene: Hmg20a Location: Chr9:56325893-56404220 bp, + strand Genetic Position: Chr9, 30.13 cM, cytoband C
• Alliance: Hmg20a^em1(IMPC)J page
• IMPC: Hmg20a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Hmg20a-8517J-1759F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAAGTATGTAAGTTCAGCA, GAAGGTAGCATATAAAAGCC, GCCCTGCTGAACATTATAGG and ACTGCGGCTTCCAAAGCAAT, which resulted in a 788 bp deletion beginning at Chromosome 9 positive strand position 56,474,209 bp CTGGTCCATTACTAGGGTTT, and ending after GCTGTTTTGATATAGGGTCT at 56,474,996 bp (GRCm38/mm10). This mutation deletes exon 3 and 643 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 34 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Hmg20a Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)