Elmod3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Elmod3^em1(IMPC)J
• Name: ELMO/CED-12 domain containing 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5901857
• Gene: Elmod3 Location: Chr6:72542905-72575396 bp, - strand Genetic Position: Chr6, 32.27 cM
• Alliance: Elmod3^em1(IMPC)J page
• IMPC: Elmod3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Elmod3-8514J-1055M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATAACCTAGCTCCTAACCCA, ACAGCAAGTGGACTTCTTGG, GCTGGAAGACTCTATTCTGA and CGCAGCTCTTCCCACCCACT, which resulted in a 351 bp deletion beginning at Chromosome 6 negative strand position 72,586,628 bp, TCCATCAGAATAGAGTCTTC, and ending after AACCCTGGGTTAGGAGCTAG at 72,586,278 bp (GRCm38/mm10). This mutation deletes exon 5 and 281 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Elmod3 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)