Kash5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kash5^em1(IMPC)J
• Name: KASH domain containing 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5901859
• Gene: Kash5 Location: Chr7:44833048-44854316 bp, - strand Genetic Position: Chr7, 29.17 cM
• Alliance: Kash5^em1(IMPC)J page
• IMPC: Kash5 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ccdc155-8506J-0155M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGTCCCAAGCCAACCACA, GCATCTAAAAGGACACGGAG, CAGACACTGTTCTTAAACCG and CTCTGGCCTGGTTACAGCAG, which resulted in a 424 bp deletion beginning at Chromosome 7 negative strand position 45,196,244 bp, AACCTGCTGATGACAGACAC, and ending after CACGGAGGGGTGAAGGGGTC at 45,195,821 bp (GRCm38/mm10). In addition there is an intronic 17 bp deletion 101 bp before the 424 bp deletion, that will not alter the result of the exon deletion. This mutation deletes exon 4 and 237 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 120 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Kash5 Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)