Nt5dc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nt5dc2^em1(IMPC)J
• Name: 5'-nucleotidase domain containing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5902345
• Gene: Nt5dc2 Location: Chr14:30853046-30861081 bp, + strand Genetic Position: Chr14, 19.09 cM
• Alliance: Nt5dc2^em1(IMPC)J page
• IMPC: Nt5dc2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Nt5dc2-8541J-1639M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGTCAGTGTCCTAGTTGAG, ATACTTAGTCAAGGGCCCCT, GGCTAGAGCCAACGGCACCA and GGTCGGCCCTGGACTGTGCA, which resulted in a 321 bp deletion beginning at Chromosome 14 positive strand position 31,136,450 bp, CAGGGGCCCTTGACTAAGTA, and ending after GGGGCTAGAGCCAACGGCAC at 31,136,770 bp (GRCm38/mm10). This mutation deletes exon 9 and 239 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 179 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nt5dc2 Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)