Dhrs11^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dhrs11^em1(IMPC)J
• Name: dehydrogenase/reductase 11; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5902359
• Gene: Dhrs11 Location: Chr11:84711682-84719820 bp, - strand Genetic Position: Chr11, 51.34 cM
• Alliance: Dhrs11^em1(IMPC)J page
• IMPC: Dhrs11 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Dhrs11-8573J-5846M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAGAGAGATCCCTATCGGA, AGAGGGATTTAGTATCCAAA, GAGCAGGTGTTAGAGCCGTG and ACTGGTTTCCTGAGGGAGAG, which resulted in a 286 bp deletion beginning at Chromosome 11 negative strand position 84,823,227 bp, CTCTAACACCTGCTCACTGG, and ending after GGGATTTAGTATCCAAACGG at 84,822,942 bp (GRCm38/mm10). This mutation deletes exon 3 and 191 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 119 and early truncation 15 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dhrs11 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)