Msl3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Msl3^em1(IMPC)J
• Name: MSL complex subunit 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5903077
• Gene: Msl3 Location: ChrX:167437113-167456894 bp, - strand Genetic Position: ChrX, 78.73 cM
• Alliance: Msl3^em1(IMPC)J page
• IMPC: Msl3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Msl3-8574J-299M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGTCAACTATATTCATACA, AGCTTGTGGAAACACTCTGT, AACTAAGTTTCTGTTCCGAA and GGATCCTATGGTTCACTGTT, which resulted in a 635 bp deletion beginning at Chromosome X negative strand position 168,670,594 bp, GCCACCACTGATGAACCCAA, and ending after TTTATACCCACAGAGTGTTT at 168,669,960 bp (GRCm38/mm10). This mutation deletes exon 5 and 543 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after residue 127. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Msl3 Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)