Rasgef1a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rasgef1a^em1(IMPC)J
• Name: RasGEF domain family, member 1A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5903207
• Gene: Rasgef1a Location: Chr6:117988466-118068507 bp, + strand Genetic Position: Chr6, 55.85 cM, cytoband F1
• Alliance: Rasgef1a^em1(IMPC)J page
• IMPC: Rasgef1a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rasgef1a-8583J-1847M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGCGACTAGGCTTACAGCA, CTGCTGCTCTTAGTCCCAGA, TGACAGATCTGGTCCTCCCT and TGCCTGCTCAGAGGAGCCTG, which resulted in a 836 bp deletion beginning at Chromosome 6 positive strand position 118,088,863 bp, GAGAGACACAGGCCCTGCTG, and ending after ACAGATCTGGTCCTCCCTAG at 118,089,698 bp (GRCm38/mm10). This mutation deletes exons 11-12 and 639 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 408 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rasgef1a Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)