Spata31d1d^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spata31d1d^em1(IMPC)J
• Name: spermatogenesis associated 31 subfamily D, member 1D; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5903219
• Gene: Spata31d1d Location: Chr13:59873739-59879566 bp, - strand Genetic Position: Chr13, 31.87 cM
• Alliance: Spata31d1d^em1(IMPC)J page
• IMPC: Spata31d1d gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Spata31d1d-8598J-8838F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAATAAGTGTATAAACTGG, GCATAGCCTACTCTTGTCAT, TGGACGTTTTGGGGATCCTA and TTCATCTGCAAGTTTCAGGC, which resulted in a 824 bp deletion beginning at Chromosome 13 negative strand position 59,730,873 bp, ATCCTAGGGAAAACATCAGG, and ending after TAGCCTACTCTTGTCATGGG at 59,730,050 bp (GRCm38/mm10). This mutation deletes exons 2-3 and 720 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an additional 14 bp deletion 27 bp after the 824 bp deletion that will not alter the results of the exon deletions. This mutation is predicted to cause a change of amino acid sequence after residue 66 and early truncation 21 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Spata31d1d Mutation: 27 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)