About   Help   FAQ
Dgkbem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dgkbem1(IMPC)J
Name: diacylglycerol kinase, beta; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5903234
Gene: Dgkb  Location: Chr12:37930169-38684238 bp, + strand  Genetic Position: Chr12, 17.11 cM
Alliance: Dgkbem1(IMPC)J page
IMPC: Dgkb gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Dgkb-8572J-5198M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTAGATGTTTCTATCTCCA, AAGATGAAGCCAAGGCTTAG, ATGTCTCTAGCAAAATAAGT and GGATACTGGATACTCTATAA, which resulted in a 566 bp deletion beginning at Chromosome 12 positive strand position 38,100,137 bp, GGAGATAGAAACATCTAACT, and ending after AGTAGGGTAGAAAATAGTAT at 38,100,702 bp (GRCm38/mm10). This mutation deletes exon 4 and 412 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dgkb Mutation:  52 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory