Idh3b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Idh3b^em1(IMPC)J
• Name: isocitrate dehydrogenase 3 (NAD+) beta; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5904256
• Gene: Idh3b Location: Chr2:130121229-130126371 bp, - strand Genetic Position: Chr2, 63.2 cM, cytoband F3
• Alliance: Idh3b^em1(IMPC)J page
• IMPC: Idh3b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Idh3b-8297J-2446F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACGCAGACACAACTAACA, AAATTCCTAAATGTCAGTAG, TTGCCTTCTTTTGGAAACCG and AGGTCAGATCGGGGACACCG, which resulted in a 772 bp deletion beginning at Chromosome 2 negative strand position 130,284,280 bp, GTGTCCCCGATCTGACCTTG, and ending after GGGTCAGACCCTGTTAGTTG at 130,283,509 bp (GRCm38/mm10). This mutation deletes exons 2,3,4 and 474 bp of intervening and flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 12 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Idh3b Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)