Rab13^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab13^em1(IMPC)J
• Name: RAB13, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5904340
• Gene: Rab13 Location: Chr3:90121022-90133694 bp, + strand Genetic Position: Chr3, 39.21 cM, cytoband F2
• Alliance: Rab13^em1(IMPC)J page
• IMPC: Rab13 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rab13-8581J-8563M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGTGTGGAAAGTATGGTGG, ACCTGAGTACCAGCAGTTAC, GGGTCAAAGGGCAATCTGGC and GGGCAATCTGGCTGGGGACT, which resulted in a 164 bp deletion beginning at Chromosome 3 positive strand position 90,222,162 bp, TTACTGGTGCAGCCCCCACT, and ending after GCTGCCCAGTCCCCAGCCAG at 90,222,325 bp (GRCm38/mm10). This mutation deletes exon 2 and 103 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 10 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rab13 Mutation: 36 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)