Sdhaf2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sdhaf2^em1(IMPC)J
• Name: succinate dehydrogenase complex assembly factor 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5904343
• Synonyms: Sdhaf2^-
• Gene: Sdhaf2 Location: Chr19:10477876-10502573 bp, - strand Genetic Position: Chr19, 6.6 cM
• Alliance: Sdhaf2^em1(IMPC)J page
• IMPC: Sdhaf2 gene page

Sdhaf2^em1(IMPC)J/Sdhaf2^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Sdhaf2-8595J-8861M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAAGATGCAGCTCAGCATA, GATATGACTTTAGACTCTAA, ATAAAGGGACCAAAATCCGC and ACAGTAACCATTGTCTAACG, which resulted in a 570 bp deletion beginning at Chromosome 19 negative strand position 10517492 bp CGCAGGACTAAGTGAGATCT, and ending after ATAACAAGCCCATTAGAGTC at 10516923 bp (GRCm38/mm10). This mutation deletes exons 2 and 3 and 242 bp of intervening and flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 16 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sdhaf2 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)