Tmem171^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem171^em1(IMPC)J
• Name: transmembrane protein 171; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5904780
• Gene: Tmem171 Location: Chr13:98822743-98831342 bp, - strand Genetic Position: Chr13, 52.13 cM
• Alliance: Tmem171^em1(IMPC)J page
• IMPC: Tmem171 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tmem171-8631J-5335M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATCAAAGCTCACAGAGCAG, GCTGAGTGTGAGCAGCGAGG, GAAACACCCTTGAGTGCGCG and ACTTGACATGGAACTGTCGC, which resulted in a 359 bp deletion beginning at Chromosome 13 negative strand position 98,688,580 bp, ACTCAAGGGTGTTTCGGCCT, and ending after TGTTTGAGATCCCGCCTCGC at 98,688,222 bp (GRCm38/mm10). This mutation deletes exon 3 and 223 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp (CTGTCG) intronic deletion 25 bp before the 359 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 213 and early truncation 86 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmem171 Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)