Rab8a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab8a^em1(IMPC)J
• Name: RAB8A, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5905648
• Gene: Rab8a Location: Chr8:72915044-72935210 bp, + strand Genetic Position: Chr8, 34.84 cM
• Alliance: Rab8a^em1(IMPC)J page
• IMPC: Rab8a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rab8a-8582J-1846M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGCGACAACAGTAGCTGAA, CTAAAGCCTTCTACAGGCTG, CCAGTGTAGAGTCCAGCGAA and CACGATTCAGGGCCCAAACA, which resulted in a 233 bp deletion beginning at Chromosome 8 positive strand position 72,168,281 bp, CTTCAGCTACTGTTGTCGCC, and ending after GCTAGTGCCTTGTTTGGGCC at 72,168,513 bp (GRCm38/mm10). This mutation deletes exon 2 and 172 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion (G) 18 bp after the exon deletion, that will not affect the results of the exon deletion. This allele is predicted to cause a change of amino acid sequence after residue 42 and early truncation 54 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rab8a Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)