Rxylt1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rxylt1^em1(IMPC)J
• Name: ribitol xylosyltransferase 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5905666
• Gene: Rxylt1 Location: Chr10:121916844-121933271 bp, - strand Genetic Position: Chr10, 70.25 cM
• Alliance: Rxylt1^em1(IMPC)J page
• IMPC: Rxylt1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tmem5-8633J-5241F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGTCTATATAACTGCTAGA, GTATTTTTCCCAAGCTGAAG, TATGGCAGTTAACTGTACGA and AGAATACTGTATTTACACCG, which resulted in a 382 bp deletion beginning at Chromosome 10 negative strand position 122,094,873 bp, CGTACAGTTAACTGCCATAT, and ending after GTCATTTCCCCTTCAGCTTG at 122,094,492 bp (GRCm38/mm10). This mutation deletes exon 3 and 279 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 14 bp deletion (TTCCTCGGTGTAAA) 64 bp before the 382 bp deletion that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 109 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rxylt1 Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)