About   Help   FAQ
Rxylt1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rxylt1em1(IMPC)J
Name: ribitol xylosyltransferase 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5905666
Gene: Rxylt1  Location: Chr10:121916844-121933271 bp, - strand  Genetic Position: Chr10, 70.25 cM
Alliance: Rxylt1em1(IMPC)J page
IMPC: Rxylt1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tmem5-8633J-5241F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGTCTATATAACTGCTAGA, GTATTTTTCCCAAGCTGAAG, TATGGCAGTTAACTGTACGA and AGAATACTGTATTTACACCG, which resulted in a 382 bp deletion beginning at Chromosome 10 negative strand position 122,094,873 bp, CGTACAGTTAACTGCCATAT, and ending after GTCATTTCCCCTTCAGCTTG at 122,094,492 bp (GRCm38/mm10). This mutation deletes exon 3 and 279 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 14 bp deletion (TTCCTCGGTGTAAA) 64 bp before the 382 bp deletion that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 109 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rxylt1 Mutation:  17 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory