Tpk1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tpk1^em1(IMPC)J
• Name: thiamine pyrophosphokinase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5905734
• Synonyms: Tpk1^-
• Gene: Tpk1 Location: Chr6:43321935-43643212 bp, - strand Genetic Position: Chr6, 21.19 cM, cytoband B2
• Alliance: Tpk1^em1(IMPC)J page
• IMPC: Tpk1 gene page

Tpk1^em1(IMPC)J/Tpk1^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tpk1-8645J-9675M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAGCGAGTCAGGGTCTACA, TAGGAAACCACCTCTGTGAG, TCTCCAGTCCATCTGAACAG and CCAGCTTCGGTAATAAAAGA, which resulted in a 415 bp deletion beginning at Chromosome 6 negative strand position 43,560,232 bp, CTGTTCAGATGGACTGGAGA, and ending after ACCACCTCTGTGAGAGGGCT at 43,559,818 bp (GRCm38/mm10). This mutation deletes exon 4 and 345 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp deletion (AAAG) 49 bp before the 415 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 39 and early truncation 49 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tpk1 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)