Tpk1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Tpk1em1(IMPC)J |
Name: |
thiamine pyrophosphokinase; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5905734 |
Gene: |
Tpk1 Location: Chr6:43321935-43643212 bp, - strand Genetic Position: Chr6, 21.19 cM, cytoband B2
|
Alliance: |
Tpk1em1(IMPC)J page
|
IMPC: |
Tpk1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Tpk1-8645J-9675M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAGCGAGTCAGGGTCTACA, TAGGAAACCACCTCTGTGAG, TCTCCAGTCCATCTGAACAG and CCAGCTTCGGTAATAAAAGA, which resulted in a 415 bp deletion beginning at Chromosome 6 negative strand position 43,560,232 bp, CTGTTCAGATGGACTGGAGA, and ending after ACCACCTCTGTGAGAGGGCT at 43,559,818 bp (GRCm38/mm10). This mutation deletes exon 4 and 345 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp deletion (AAAG) 49 bp before the 415 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 39 and early truncation 49 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
4 reference(s) |
|