Taf13^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Taf13^em1(IMPC)J
• Name: TATA-box binding protein associated factor 13; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5905737
• Synonyms: Taf13^-
• Gene: Taf13 Location: Chr3:108479015-108489384 bp, + strand Genetic Position: Chr3, 47.34 cM
• Alliance: Taf13^em1(IMPC)J page
• IMPC: Taf13 gene page

Taf13^em1(IMPC)J/Taf13^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Taf13-8618J-6493M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTATACTTTCCATACCAACT, CATTGGTCAGTCTCTGAGTC, GCACAAAGCAGGCACTCTAA and TGATGTGATATTCAGAGTAA, which resulted in a 310 bp deletion beginning at Chromosome 3 positive strand position 108,578,035 bp, GTTTAATCCTAGTTGGTATG, and ending after CTATCCATTAGAGTGCCTGC at 108,578,344 bp (GRCm38/mm10). This mutation deletes exon 3 and 212 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 35 and early truncation 15 amino acids later. Although mutant mRNA is produced, a mutant protein likely retains no TAF13 functions based on early missense amino acids and early termination. (J:188991, J:348275)
• Inheritance: Not Specified

Expression

In Mice Carrying this Mutation:	24 assay results
In Structures Affected by this Mutation:	10 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Taf13 Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)