About   Help   FAQ
Taf13em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Taf13em1(IMPC)J
Name: TATA-box binding protein associated factor 13; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5905737
Synonyms: Taf13-
Gene: Taf13  Location: Chr3:108479015-108489384 bp, + strand  Genetic Position: Chr3, 47.34 cM
Alliance: Taf13em1(IMPC)J page
IMPC: Taf13 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Taf13-8618J-6493M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTATACTTTCCATACCAACT, CATTGGTCAGTCTCTGAGTC, GCACAAAGCAGGCACTCTAA and TGATGTGATATTCAGAGTAA, which resulted in a 310 bp deletion beginning at Chromosome 3 positive strand position 108,578,035 bp, GTTTAATCCTAGTTGGTATG, and ending after CTATCCATTAGAGTGCCTGC at 108,578,344 bp (GRCm38/mm10). This mutation deletes exon 3 and 212 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 35 and early truncation 15 amino acids later. Although mutant mRNA is produced, a mutant protein likely retains no TAF13 functions based on early missense amino acids and early termination. (J:188991, J:348275)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 14 assay results
In Structures Affected by this Mutation: 9 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Taf13 Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/21/2024
MGI 6.24
The Jackson Laboratory