Zscan5b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zscan5b^em1(IMPC)J
• Name: zinc finger and SCAN domain containing 5B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5905771
• Gene: Zscan5b Location: Chr7:6225277-6242416 bp, + strand Genetic Position: Chr7, 3.61 cM, cytoband A1
• Alliance: Zscan5b^em1(IMPC)J page
• IMPC: Zscan5b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zscan5b-8665J-4435M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATTCGTTTATGTGGGATAAT, TATGAATGTTCCCACAACTC, GCCAACACCAGAGTTGAGTT and TACCCTTGTCTGACACTCTT, which resulted in a 370 bp deletion beginning at Chromosome 7 positive strand position 6,233,707 bp, CTCTGGAAAAAAGTGAGTGT, and ending after CCAGAGTTGAGTTTGGACAA at 6,234,076 bp (GRCm38/mm10). This mutation deletes exon 5 and 216 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 187 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zscan5b Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)