Slc9a9^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc9a9^em1(IMPC)J
• Name: solute carrier family 9 (sodium/hydrogen exchanger), member 9; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5905784
• Gene: Slc9a9 Location: Chr9:94551962-95112498 bp, + strand Genetic Position: Chr9, 49.22 cM
• Alliance: Slc9a9^em1(IMPC)J page
• IMPC: Slc9a9 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Slc9a9-8597J-8865F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGTCAACTATGGGAGACGT, TGTGTCGTTGGAATAAGTCA, AGGCGTATACCTATGTAAAG and ATACAACGCAAATACAGCCC, which resulted in a 563 bp deletion beginning at Chromosome 9 positive strand position 94,684,901 bp, GTAAGTATCTGTGAGTAAAC, and ending after TTTTCCAGCAAGCCAGGGCT at 94,685,463 bp (GRCm38/mm10). This mutation deletes exon 2 and 360 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 19 bp deletion (AGTCAGTAATGTCCGTGAC) 25 bp before the 563 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 58 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc9a9 Mutation: 42 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)