Trp53i11^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trp53i11^em1(IMPC)J
• Name: transformation related protein 53 inducible protein 11; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5905785
• Gene: Trp53i11 Location: Chr2:93017893-93032104 bp, + strand Genetic Position: Chr2, 51.37 cM
• Alliance: Trp53i11^em1(IMPC)J page
• IMPC: Trp53i11 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Trp53i11-8646J-9616F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATGGCCCCCAGGTGTCCAC, GAGAGGTTGAGCTTGCATTG, GTAGGACCTTACACATACCC and CTGTGCAACCCAAACAGCCA, which resulted in a 235 bp deletion beginning at Chromosome 2 positive strand position 93,198,127 bp, TTGGGGAAAACATTTATGTT, and ending after GGATGGTTTTGTGTCCCGGG at 93,198,361 bp (GRCm38/mm10). This mutation deletes exon 4 and 176 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 21 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Trp53i11 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)