Sike1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Sike1em1(IMPC)J |
Name: |
suppressor of IKBKE 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5905812 |
Gene: |
Sike1 Location: Chr3:102903056-102911230 bp, + strand Genetic Position: Chr3, 45.25 cM, cytoband F3
|
Alliance: |
Sike1em1(IMPC)J page
|
IMPC: |
Sike1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Sike1-8664J-4439M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAGGGGTGGACGCTGCGGG, CTGATTTATCTTGGTCTGGA, GGGAGTGACCACATACCAAA and AGCAGAGTTGAATTGTTAGA, which resulted in a 572 bp deletion in total. This deletion begins at Chromosome 3 positive strand position 102,995,979 bp, GCCGAGCCGCGCCCAGGGGT, deleting 369 bp, then retains 4 endogenous bp (AGTG) in the intron, then removes 203 bp ending after ACCAAATGGAGGCTTCTATA at 102,996,554 bp (GRCm38/mm10). This mutation deletes exon 2 and 470 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 14 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|