Zfp202^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp202^em1(IMPC)J
• Name: zinc finger protein 202; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5906318
• Gene: Zfp202 Location: Chr9:40103612-40124900 bp, + strand Genetic Position: Chr9, 21.42 cM, cytoband B
• Alliance: Zfp202^em1(IMPC)J page
• IMPC: Zfp202 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zfp202-8671J-6805M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATTAAAGGTTGAAAGAAGG, AAATTCCTGCTTGTCATCAG, GGGGTTCTCTTGTACCACAA and TCGAGAAGCTGATCTAAAGT, which resulted in a 652 bp deletion beginning at Chromosome 9 positive strand position 40,208,107 bp, AAGGGGGAAATTAGAAGAGT, and ending after GACAATTCTGCCCACTTTAG at 40,208,758 bp (GRCm38/mm10). This mutation deletes exon 3 and 441 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 134 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp202 Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)