Ccdc85b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc85b^em1(IMPC)J
• Name: coiled-coil domain containing 85B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907253
• Gene: Ccdc85b Location: Chr19:5503191-5507591 bp, - strand Genetic Position: Chr19, 4.33 cM
• Alliance: Ccdc85b^em1(IMPC)J page
• IMPC: Ccdc85b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ccdc85b-8691J-5050M was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences CCCTCAGTCATCAGGGGAGC and GGAGGCCGAAGCAGGCGGCC, which resulted in a 680 bp deletion beginning at Chromosome 19 negative strand position 5,457,391 bp, GCCGAAGCAGGCGGCCTGGA, and ending after GCTGTGGACCTCCAGACCTG at 5,456,712 bp (GRCm38/mm10). This mutation deletes all of exon ENSMUSE00001034635 except the first 6 bp and an additional 77 bp of flanking intronic sequence and is predicted to cause early truncation after 2 amino acids. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccdc85b Mutation: 4 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)