Cnot10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cnot10^em1(IMPC)J
• Name: CCR4-NOT transcription complex, subunit 10; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907612
• Gene: Cnot10 Location: Chr9:114414946-114469252 bp, - strand Genetic Position: Chr9, 64.72 cM
• Alliance: Cnot10^em1(IMPC)J page
• IMPC: Cnot10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences CTAACATATAGCTCAGATTT, AATGCACTCTAACAACAGCA, TTGTTAGAGTGCATTCTGCC, which resulted in a 234 bp deletion spanning ENSMUSE00000448470 (exon 4) beginning at Chromosome 9 negative strand position 114,629,178 bp ATTCTGCCCGGATTGTTTCA, and ending after TAGATGACCTAAATCTGAGC at 114,628,945 bp (GRCm38/mm10). This mutation deletes exon 4 and 83 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 93 and early truncation 12 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cnot10 Mutation: 103 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)