Asf1b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Asf1b^em1(IMPC)J
• Name: anti-silencing function 1B histone chaperone; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907638
• Gene: Asf1b Location: Chr8:84682323-84696824 bp, + strand Genetic Position: Chr8, 40.22 cM
• Alliance: Asf1b^em1(IMPC)J page
• IMPC: Asf1b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences AGAGGCCTAATTTTCCCGGG, CGAGAGGAACCATATAGTAG, AGTGTGCTTTCAGGTAAAAG, which resulted in a 526 bp deletion spanning ENSMUSE00001257874 (exon 2) beginning at Chromosome 8 positive strand position 83,964,745 bp CTACTATATGGTTCCTCTCG, and ending after CTAGAACCTTCCTCTTTTAC at 83,965,270 bp (GRCm38/mm10). This mutation deletes exon 2 and 410 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 36 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Asf1b Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)