Zfp706^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp706^em1(IMPC)J
• Name: zinc finger protein 706; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907827
• Gene: Zfp706 Location: Chr15:36997271-37007646 bp, - strand Genetic Position: Chr15, 14.59 cM
• Alliance: Zfp706^em1(IMPC)J page
• IMPC: Zfp706 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTGACTGTAGATAATATCCT, ACTGCTAGCTGGGAAAATGT, CCAGACAGTTCAAATATCAT and TATACTCATTTGTCATCTAG, which resulted in a 629 bp deletion beginning at Chromosome 15 positive strand position 37,003,474 bp, CTACATTTTCCCAGCTAGCA, and ending after AGTTCAAATATCATTGGTAA at 37,004,102 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000514075 (exon 2) and 492 bp of flanking intronic sequence including the start site and is predicted to cause a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp706 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)