About   Help   FAQ
Akr1c19em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Akr1c19em1(IMPC)J
Name: aldo-keto reductase family 1, member C19; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5907829
Gene: Akr1c19  Location: Chr13:4283499-4298360 bp, + strand  Genetic Position: Chr13, 2.36 cM
Alliance: Akr1c19em1(IMPC)J page
IMPC: Akr1c19 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TCATAGAACTGGATTATCAC, CAGAATTAAACTCCAAGGTG, AGGAGGCTTCTGAACTCATA, which resulted in a 520 bp deletion beginning at Chromosome 13 positive strand position 4,242,346 bp GTGTGGCTCATAGAACTGGA, and ending after TTGAGTGGGTACCCTATGAG at 4,242,865 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000980302 (exon 6) and 410 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 190 and early truncation 11 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Akr1c19 Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory