Rab10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab10^em1(IMPC)J
• Name: RAB10, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907845
• Gene: Rab10 Location: Chr12:3297428-3359969 bp, - strand Genetic Position: Chr12, 1.71 cM
• Alliance: Rab10^em1(IMPC)J page
• IMPC: Rab10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences ATAAACTGTTTAGATTGTTG, ATAAGCTCCACACTTCATAG, GCTGAGCTCAAACTTTAGGA, which resulted in a 452 bp deletion beginning at Chromosome 12 positive strand position 3,256,825 bp, ATTGTTGAGGGAGAGAGGGC, and ending after ATAAGCTCCACACTTCATAG at 3,257,276 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000462111 (exon 3) and 313 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 62 and early truncation 11 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rab10 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)