Zfp407^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp407^em1(IMPC)J
• Name: zinc finger protein 407; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5907859
• Synonyms: Zfp407^-
• Gene: Zfp407 Location: Chr18:84225826-84612815 bp, - strand Genetic Position: Chr18, 57.53 cM
• Alliance: Zfp407^em1(IMPC)J page
• IMPC: Zfp407 gene page

Zfp407^em1(IMPC)J/Zfp407^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as stalled cleavage stage embryos. Mutants fail to hatch from the zona with no further development in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCCTGGCTCTCACAGCAA, TTACCATAACAAAGGGAAGG, GCAGTTCTCACCTAGACTGA, and TGTATGGGTGAGATAATTAT, which resulted in a 423 bp deletion beginning at Chromosome 18 negative strand position 84,553,166 bp, GTGAGATAATTATGGGAATA, and ending after TGCGTATCCTCCTTCCCTTT at 84,552,744 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001220921 (exon 3) and 308 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1554 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp407 Mutation: 102 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)