About   Help   FAQ
Zfp407em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp407em1(IMPC)J
Name: zinc finger protein 407; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5907859
Synonyms: Zfp407-
Gene: Zfp407  Location: Chr18:84225826-84612815 bp, - strand  Genetic Position: Chr18, 57.53 cM
Alliance: Zfp407em1(IMPC)J page
IMPC: Zfp407 gene page
Zfp407em1(IMPC)J/Zfp407em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as stalled cleavage stage embryos. Mutants fail to hatch from the zona with no further development in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCCTGGCTCTCACAGCAA, TTACCATAACAAAGGGAAGG, GCAGTTCTCACCTAGACTGA, and TGTATGGGTGAGATAATTAT, which resulted in a 423 bp deletion beginning at Chromosome 18 negative strand position 84,553,166 bp, GTGAGATAATTATGGGAATA, and ending after TGCGTATCCTCCTTCCCTTT at 84,552,744 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001220921 (exon 3) and 308 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1554 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp407 Mutation:  102 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory